ID: 1159594444

View in Genome Browser
Species Human (GRCh38)
Location 18:70369549-70369571
Sequence CAGCCTGTGGACCAAAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159594438_1159594444 8 Left 1159594438 18:70369518-70369540 CCTGCCATATTTTAAAGTTCTTG No data
Right 1159594444 18:70369549-70369571 CAGCCTGTGGACCAAAGTGTGGG No data
1159594437_1159594444 15 Left 1159594437 18:70369511-70369533 CCTAGAACCTGCCATATTTTAAA No data
Right 1159594444 18:70369549-70369571 CAGCCTGTGGACCAAAGTGTGGG No data
1159594439_1159594444 4 Left 1159594439 18:70369522-70369544 CCATATTTTAAAGTTCTTGAGAT No data
Right 1159594444 18:70369549-70369571 CAGCCTGTGGACCAAAGTGTGGG No data
1159594436_1159594444 16 Left 1159594436 18:70369510-70369532 CCCTAGAACCTGCCATATTTTAA No data
Right 1159594444 18:70369549-70369571 CAGCCTGTGGACCAAAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159594444 Original CRISPR CAGCCTGTGGACCAAAGTGT GGG Intergenic
No off target data available for this crispr