ID: 1159600605

View in Genome Browser
Species Human (GRCh38)
Location 18:70425314-70425336
Sequence TAGGCTAGTCTGAAATTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159600604_1159600605 -10 Left 1159600604 18:70425301-70425323 CCATGGGGCTGGATAGGCTAGTC No data
Right 1159600605 18:70425314-70425336 TAGGCTAGTCTGAAATTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159600605 Original CRISPR TAGGCTAGTCTGAAATTTGC AGG Intergenic
No off target data available for this crispr