ID: 1159600944

View in Genome Browser
Species Human (GRCh38)
Location 18:70428141-70428163
Sequence ACAGCCTTTAAATGAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159600944_1159600946 14 Left 1159600944 18:70428141-70428163 CCTGCTTTTCATTTAAAGGCTGT No data
Right 1159600946 18:70428178-70428200 ATAACTTCAAGCTAGAAGGTAGG No data
1159600944_1159600948 27 Left 1159600944 18:70428141-70428163 CCTGCTTTTCATTTAAAGGCTGT No data
Right 1159600948 18:70428191-70428213 AGAAGGTAGGACTAGGAGTGCGG No data
1159600944_1159600947 20 Left 1159600944 18:70428141-70428163 CCTGCTTTTCATTTAAAGGCTGT No data
Right 1159600947 18:70428184-70428206 TCAAGCTAGAAGGTAGGACTAGG No data
1159600944_1159600945 10 Left 1159600944 18:70428141-70428163 CCTGCTTTTCATTTAAAGGCTGT No data
Right 1159600945 18:70428174-70428196 AATGATAACTTCAAGCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159600944 Original CRISPR ACAGCCTTTAAATGAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr