ID: 1159604718

View in Genome Browser
Species Human (GRCh38)
Location 18:70463184-70463206
Sequence ATGTCTGAGGTCCCCCTAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159604718_1159604721 4 Left 1159604718 18:70463184-70463206 CCGTTTAGGGGGACCTCAGACAT No data
Right 1159604721 18:70463211-70463233 CTGCATAGTGTCATTGTCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159604718 Original CRISPR ATGTCTGAGGTCCCCCTAAA CGG (reversed) Intergenic
No off target data available for this crispr