ID: 1159609121

View in Genome Browser
Species Human (GRCh38)
Location 18:70507142-70507164
Sequence TTGGCTACCTACAGCCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159609121_1159609127 24 Left 1159609121 18:70507142-70507164 CCATGGTGGCTGTAGGTAGCCAA No data
Right 1159609127 18:70507189-70507211 CCTGAAAGGCAGTAACCCTCAGG No data
1159609121_1159609124 10 Left 1159609121 18:70507142-70507164 CCATGGTGGCTGTAGGTAGCCAA No data
Right 1159609124 18:70507175-70507197 ACATGATGATTCTCCCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159609121 Original CRISPR TTGGCTACCTACAGCCACCA TGG (reversed) Intergenic
No off target data available for this crispr