ID: 1159618422

View in Genome Browser
Species Human (GRCh38)
Location 18:70609106-70609128
Sequence CAGAATCCACAGTAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159618416_1159618422 0 Left 1159618416 18:70609083-70609105 CCTATTAGGGCCCAAGTTAGTCC No data
Right 1159618422 18:70609106-70609128 CAGAATCCACAGTAGGAGCAAGG No data
1159618417_1159618422 -10 Left 1159618417 18:70609093-70609115 CCCAAGTTAGTCCCAGAATCCAC No data
Right 1159618422 18:70609106-70609128 CAGAATCCACAGTAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159618422 Original CRISPR CAGAATCCACAGTAGGAGCA AGG Intergenic
No off target data available for this crispr