ID: 1159620730

View in Genome Browser
Species Human (GRCh38)
Location 18:70635345-70635367
Sequence TATTGCTGTCCCTACTTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159620730_1159620731 7 Left 1159620730 18:70635345-70635367 CCTGTTAAGTAGGGACAGCAATA 0: 1
1: 0
2: 1
3: 18
4: 112
Right 1159620731 18:70635375-70635397 TAGACAATGCACAAAGTATGAGG 0: 1
1: 0
2: 2
3: 6
4: 167
1159620730_1159620732 26 Left 1159620730 18:70635345-70635367 CCTGTTAAGTAGGGACAGCAATA 0: 1
1: 0
2: 1
3: 18
4: 112
Right 1159620732 18:70635394-70635416 GAGGATAATGTAAGACAGATAGG 0: 1
1: 0
2: 1
3: 12
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159620730 Original CRISPR TATTGCTGTCCCTACTTAAC AGG (reversed) Intronic
902554037 1:17236307-17236329 TATTACTGTCCCCATTTTACAGG - Intronic
902956318 1:19926271-19926293 GATTACTGTCCCTACTTGACAGG + Intergenic
905683398 1:39890942-39890964 TATTGCTGTCACTATGTAGCTGG + Intergenic
910778716 1:90902990-90903012 TATTGCTGGGCCTCCTTAAATGG - Intergenic
914935743 1:151978253-151978275 TATTACTGTTCCCACTTTACAGG - Intergenic
915686750 1:157641861-157641883 TATTGTTGTCCCTATTTCACAGG + Intergenic
916651453 1:166838528-166838550 TCTTGCTGAACCCACTTAACAGG - Intergenic
916723713 1:167504181-167504203 TATTGATGTCCCCACTTGATAGG - Intronic
1067859819 10:49834389-49834411 TACTGCTGTCTCTAAATAACTGG + Intronic
1068954717 10:62812769-62812791 TTTTGCTGTCCCCACTTGAAGGG + Exonic
1070326384 10:75392131-75392153 TATTACTGTCCCCATTTTACAGG - Intergenic
1072086917 10:92088760-92088782 TATGGGTGTCCCTACTCAACAGG - Intronic
1078394757 11:10971433-10971455 TAGTGTTGTTCCTACTTTACAGG + Intergenic
1078652855 11:13212138-13212160 TATTGCTATCACTTCTCAACTGG - Intergenic
1079204284 11:18400513-18400535 TACTCCTGTTTCTACTTAACTGG - Intronic
1085083446 11:73651712-73651734 TATTCCTGTCCCTGCTTTACTGG + Intronic
1085920243 11:80946025-80946047 TATTTGTATCCCTACTTAACAGG - Intergenic
1086822767 11:91455384-91455406 GATCACTGTCCCTACTTACCTGG - Intergenic
1087431310 11:98058953-98058975 TATTTCTGTCCCTATTTAACTGG + Intergenic
1088390310 11:109306729-109306751 TATTGTTATCCCTATTTTACAGG - Intergenic
1088453443 11:110007745-110007767 ATTTGCTTTCCTTACTTAACAGG + Intergenic
1091130145 11:133139382-133139404 TATTACTATCCCCACTTTACAGG + Intronic
1093272554 12:17082381-17082403 TATTGCTGTAGCTTCTTAAATGG + Intergenic
1094392961 12:29973061-29973083 TATTATTGTCCCTACCTTACAGG + Intergenic
1100016307 12:90014956-90014978 TATTACTATCCCTACTTTACAGG - Intergenic
1101647075 12:106641334-106641356 TATTGCTATCCCCATTTTACAGG - Intronic
1106762568 13:32881370-32881392 TATGGCTGTGTCTCCTTAACTGG - Intergenic
1107217413 13:37937497-37937519 CATTTCTGTCCCTTCTTCACTGG - Intergenic
1108976677 13:56452944-56452966 TATTACTGTTCCTTCTTAAAAGG + Intergenic
1113718344 13:112531191-112531213 TATTCATGTGCCTACTTACCAGG - Intronic
1114645412 14:24253306-24253328 TATTGCTATCCCTGCTTTACAGG + Intronic
1114960934 14:27888233-27888255 TCTTGCTAAGCCTACTTAACAGG + Intergenic
1117676664 14:58162212-58162234 TATTGCTGTGGCTACTTCAAAGG - Intronic
1121675268 14:95747298-95747320 TATTGTTATCCCTATTTGACAGG + Intergenic
1125168078 15:36734174-36734196 TATAGATGTTCCTACTTTACGGG - Intronic
1126457867 15:48884026-48884048 CATAGGTGTCCCTACCTAACTGG - Intronic
1131637656 15:94254308-94254330 GATTGCCATCCCTACGTAACTGG - Intronic
1143202224 17:5121103-5121125 TATTGCTGTCCCTAGGACACTGG - Intronic
1144135013 17:12286398-12286420 TTTTGCTGTCTCTACTTCATTGG + Intergenic
1144633236 17:16886604-16886626 TATTGCTGTGACAACTTTACAGG - Intergenic
1149948373 17:60956660-60956682 CAGTGATGTTCCTACTTAACAGG + Intronic
1150751354 17:67865663-67865685 TATTTCTGTCCCCACTCAAAAGG - Intronic
1155186058 18:23387356-23387378 TATTGTTATCCCTGCTTTACAGG - Intronic
1156747892 18:40414931-40414953 TATTCTTGTCCCTACTTAAAAGG + Intergenic
1158268745 18:55689055-55689077 TTTTCCTTTCCCTACTTAAGAGG - Intergenic
1159620730 18:70635345-70635367 TATTGCTGTCCCTACTTAACAGG - Intronic
1164891277 19:31825777-31825799 CATTGCTGTCCCTCTTAAACGGG + Intergenic
1167082485 19:47286469-47286491 TATTGCTGTCCCCCCTTTAAGGG - Intergenic
927600413 2:24435550-24435572 TATTGCTTTCCATCCTGAACTGG + Intergenic
930166560 2:48209250-48209272 TATATCTGCCCCTACTGAACTGG - Intergenic
932117890 2:69069662-69069684 TATTACTGTCCTTACATTACAGG - Intronic
935292277 2:101620739-101620761 TATTGCTCTCCCTCCTCACCAGG - Intergenic
936627934 2:114168543-114168565 AATAGCTGTACCTACTTCACGGG - Intergenic
941037000 2:160579818-160579840 TATTGCTCTCCCCATTTTACAGG + Intergenic
942260060 2:174150815-174150837 TATTGCTCTCCCTTTTTAATAGG - Intronic
942314502 2:174684908-174684930 TATTGTTATCCCTATTTTACTGG - Intergenic
942694274 2:178621865-178621887 TCTCGCTGTCCTTACTTCACAGG + Exonic
942901197 2:181121302-181121324 TATTTCTGCCTCTACTCAACTGG - Intergenic
944823393 2:203454946-203454968 TATTGTTGCCCCTATTTAACTGG - Intronic
946739033 2:222783788-222783810 TATACCTGTCCCTTCTTATCAGG - Intergenic
1168943618 20:1733402-1733424 TATTCCTGCCCCACCTTAACTGG - Intergenic
1178236382 21:30846958-30846980 TCCTGCTGTCCATACCTAACTGG - Intergenic
1182185485 22:28397327-28397349 TCTTACTGTCCTCACTTAACAGG + Intronic
1183063538 22:35349295-35349317 TCATTCTCTCCCTACTTAACTGG + Intergenic
950117156 3:10458742-10458764 TGTTGCTGTCCCCACTTTATAGG + Intronic
950699143 3:14727990-14728012 TCTTGCTTTCCCTACTAGACTGG - Intronic
951225054 3:20111234-20111256 TATTGTTGTCCCCATTTTACAGG + Intronic
951929155 3:27944169-27944191 TATCTCTTTCCCTACTCAACTGG - Intergenic
954709402 3:52497853-52497875 TGTTGCTGCCCTTACTGAACAGG - Intronic
957379155 3:79402614-79402636 TATTGCTATCTCCATTTAACAGG + Intronic
958428981 3:94015443-94015465 TATTTCTTTCCCTATTTAAATGG - Intronic
959616466 3:108353721-108353743 AATTGCTGTTCCTACATAGCAGG - Exonic
963486492 3:145940568-145940590 TATTGCTATCTCTAGTTTACAGG + Intergenic
972381592 4:38524891-38524913 TATTAGTGTCCCCACTTTACAGG - Intergenic
974169496 4:58247502-58247524 TTTTGCTGCCACTACTTAACAGG + Intergenic
974362059 4:60894075-60894097 TATTGGTGTCCCTACTTTTGAGG + Intergenic
974771257 4:66416941-66416963 TAATGCAGTCCCTATTTTACAGG + Intergenic
975893734 4:79060815-79060837 AATTACTGTCCCTATTTTACAGG - Intergenic
976434964 4:85006741-85006763 AATTACTGTTCCTACTTAAGTGG + Intergenic
977923745 4:102674733-102674755 TCTTGCTGCCCATGCTTAACTGG - Intronic
979636498 4:122961103-122961125 TAGTGTTATCCCTACTTAGCTGG - Intronic
980255256 4:130371788-130371810 TTTTGCTAAACCTACTTAACAGG + Intergenic
980708081 4:136525094-136525116 TATTGCCTTCCCTCCTTCACAGG + Intergenic
986071499 5:4289002-4289024 TCTTGATTTCCCTACTTAACAGG - Intergenic
989107588 5:37878322-37878344 TATTACTGTCCCCATTTTACAGG - Intergenic
990586971 5:57221000-57221022 TATTGCATTCTCTACTTAAACGG + Intronic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
993026254 5:82650385-82650407 GATTGCAGTCCCTACCTCACAGG - Intergenic
994023673 5:95057638-95057660 TATTCCTGTCCCAAATTATCAGG - Intronic
997912996 5:137895038-137895060 TGTTGCTGCCCCTACTAAAATGG + Intronic
1000247801 5:159463375-159463397 TATTGCAGTACCTACTTCATAGG - Intergenic
1001069357 5:168570880-168570902 TATCGCTGGCCTTACTTTACTGG - Intronic
1001828514 5:174766047-174766069 TATTACTATCCCCACTTAAGGGG - Intergenic
1004567382 6:16811264-16811286 TCTTGATGTTCCTATTTAACAGG - Intergenic
1005300311 6:24464256-24464278 TATTGCTGTCCCAATTTTATAGG + Intronic
1012854161 6:104481651-104481673 TATTGTTTTCCCAATTTAACAGG + Intergenic
1013931355 6:115537736-115537758 TATTTCTGTCTCTCATTAACTGG + Intergenic
1020749112 7:12117259-12117281 TACTTATGTCCCTACTGAACAGG + Intergenic
1022017909 7:26367777-26367799 GATGGCTGGCCCTACTTAACAGG - Intronic
1022290956 7:29002235-29002257 CAGTGCTGTCCCTCCTTGACAGG - Intronic
1026178290 7:68016800-68016822 TATCACTGTCCCTATTTTACAGG + Intergenic
1031370803 7:120963613-120963635 TATTACTGTCTCTACTTTATAGG - Intronic
1033280790 7:140004988-140005010 TGTTGCTGTCCACACTTCACAGG - Intronic
1039247199 8:35621986-35622008 TACTACTGTTCCTACTTAAAAGG + Intronic
1042272716 8:66971560-66971582 TAGGGCTGTCCCTACTTAAAAGG - Intronic
1042659523 8:71138765-71138787 TATTGCTGTCATCAGTTAACTGG + Intergenic
1045155235 8:99461571-99461593 AATTGTTTTCCCTACTTAACAGG + Intronic
1047564853 8:126032805-126032827 TATCGCTGTCCTCACTTAAAAGG - Intergenic
1048285261 8:133136649-133136671 TATTGCTGTCCCAACAAAGCTGG + Intergenic
1048869875 8:138788404-138788426 TATTGCTGTCCTTGTTTTACAGG - Intronic
1050066050 9:1760401-1760423 TATCACTGTCCCTATTTTACAGG - Intergenic
1050991027 9:12152319-12152341 TATTGGTTTCCCTACTTTAGAGG + Intergenic
1052608099 9:30732057-30732079 TAATGGTGTCCCTACTTTTCTGG - Intergenic
1056123453 9:83512086-83512108 AATTGATGTCCCTATTTTACAGG - Intronic
1059830350 9:118088149-118088171 TATTTCAGTGTCTACTTAACTGG - Intergenic
1059861068 9:118462577-118462599 TATTGCTGGCCCTAATTATCAGG + Intergenic
1059861300 9:118465928-118465950 TATTGCTGGCCCTAATTATCAGG + Intergenic
1059994484 9:119895531-119895553 TATTGCTGTCCTCATTTGACAGG + Intergenic
1060846577 9:126842301-126842323 CATTGCCGTCCCTATCTAACAGG + Intergenic
1062174592 9:135153883-135153905 TGTTGCTGTCCCCACTGTACAGG - Intergenic
1186435847 X:9542700-9542722 TCTTGCTAGCCCTACCTAACAGG - Intronic
1189710810 X:43809842-43809864 TTCTGCTGGACCTACTTAACAGG - Intronic
1191664050 X:63680243-63680265 TATTGCTGTGGCTTCTTAAGTGG - Intronic
1193659752 X:84243148-84243170 TATTTTTGTCCCTACTTTCCAGG - Intergenic
1194079050 X:89435187-89435209 TATTCCTGACCCAACTTATCTGG - Intergenic
1195830105 X:109047587-109047609 TCTTTTTGTCCCTACTAAACTGG + Intergenic
1196034289 X:111126609-111126631 TATTACTATCCTCACTTAACAGG - Intronic
1196136177 X:112212027-112212049 TATTGTTATCCCTAGTTTACAGG - Intergenic
1196888137 X:120266584-120266606 TATTATTGTCCCTACTTAAAGGG + Intronic
1196888663 X:120271383-120271405 TATTACTGTCTCTGTTTAACAGG - Intronic
1197603566 X:128559210-128559232 TCTTGATGTCCCTTCTTAATGGG + Intergenic
1200431672 Y:3090504-3090526 TATTCCTGACCCAACTTAACTGG - Intergenic