ID: 1159622166

View in Genome Browser
Species Human (GRCh38)
Location 18:70651107-70651129
Sequence CTGTAGGGCTTTAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159622158_1159622166 22 Left 1159622158 18:70651062-70651084 CCCCGGAAGCAGTCTGGTCTTGA No data
Right 1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG No data
1159622160_1159622166 20 Left 1159622160 18:70651064-70651086 CCGGAAGCAGTCTGGTCTTGATT No data
Right 1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG No data
1159622159_1159622166 21 Left 1159622159 18:70651063-70651085 CCCGGAAGCAGTCTGGTCTTGAT No data
Right 1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159622166 Original CRISPR CTGTAGGGCTTTAGGGAGGA TGG Intergenic
No off target data available for this crispr