ID: 1159624005

View in Genome Browser
Species Human (GRCh38)
Location 18:70670450-70670472
Sequence GTGGACAAAAGTGCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159624005_1159624012 7 Left 1159624005 18:70670450-70670472 CCCACAAAGGCACTTTTGTCCAC No data
Right 1159624012 18:70670480-70670502 TGGAAAATTGTTGCTTCTGTAGG No data
1159624005_1159624013 8 Left 1159624005 18:70670450-70670472 CCCACAAAGGCACTTTTGTCCAC No data
Right 1159624013 18:70670481-70670503 GGAAAATTGTTGCTTCTGTAGGG No data
1159624005_1159624017 21 Left 1159624005 18:70670450-70670472 CCCACAAAGGCACTTTTGTCCAC No data
Right 1159624017 18:70670494-70670516 TTCTGTAGGGGGATGATGGCTGG No data
1159624005_1159624015 10 Left 1159624005 18:70670450-70670472 CCCACAAAGGCACTTTTGTCCAC No data
Right 1159624015 18:70670483-70670505 AAAATTGTTGCTTCTGTAGGGGG No data
1159624005_1159624014 9 Left 1159624005 18:70670450-70670472 CCCACAAAGGCACTTTTGTCCAC No data
Right 1159624014 18:70670482-70670504 GAAAATTGTTGCTTCTGTAGGGG No data
1159624005_1159624016 17 Left 1159624005 18:70670450-70670472 CCCACAAAGGCACTTTTGTCCAC No data
Right 1159624016 18:70670490-70670512 TTGCTTCTGTAGGGGGATGATGG No data
1159624005_1159624019 23 Left 1159624005 18:70670450-70670472 CCCACAAAGGCACTTTTGTCCAC No data
Right 1159624019 18:70670496-70670518 CTGTAGGGGGATGATGGCTGGGG No data
1159624005_1159624018 22 Left 1159624005 18:70670450-70670472 CCCACAAAGGCACTTTTGTCCAC No data
Right 1159624018 18:70670495-70670517 TCTGTAGGGGGATGATGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159624005 Original CRISPR GTGGACAAAAGTGCCTTTGT GGG (reversed) Intergenic
No off target data available for this crispr