ID: 1159624411

View in Genome Browser
Species Human (GRCh38)
Location 18:70675384-70675406
Sequence GTGTGTAAAGGGATGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159624391_1159624411 23 Left 1159624391 18:70675338-70675360 CCCAGACAGAGACCAAAACCTGA No data
Right 1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG No data
1159624392_1159624411 22 Left 1159624392 18:70675339-70675361 CCAGACAGAGACCAAAACCTGAG No data
Right 1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG No data
1159624402_1159624411 5 Left 1159624402 18:70675356-70675378 CCTGAGAATGGGGGTGGGAGGGA No data
Right 1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG No data
1159624397_1159624411 11 Left 1159624397 18:70675350-70675372 CCAAAACCTGAGAATGGGGGTGG No data
Right 1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159624411 Original CRISPR GTGTGTAAAGGGATGGGGGA AGG Intergenic
No off target data available for this crispr