ID: 1159628409

View in Genome Browser
Species Human (GRCh38)
Location 18:70720855-70720877
Sequence CTGTTGGCACAGCTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159628405_1159628409 5 Left 1159628405 18:70720827-70720849 CCAAACAGCATTTGACTAAGGCT No data
Right 1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159628409 Original CRISPR CTGTTGGCACAGCTGGAGCT TGG Intergenic
No off target data available for this crispr