ID: 1159634269

View in Genome Browser
Species Human (GRCh38)
Location 18:70786252-70786274
Sequence GGCACATATGTCAATTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159634269_1159634273 25 Left 1159634269 18:70786252-70786274 CCTCCTCAATTGACATATGTGCC No data
Right 1159634273 18:70786300-70786322 GAAGAGCCAGCAGACCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159634269 Original CRISPR GGCACATATGTCAATTGAGG AGG (reversed) Intergenic
No off target data available for this crispr