ID: 1159634665

View in Genome Browser
Species Human (GRCh38)
Location 18:70790091-70790113
Sequence CATGAGAGGGAGCTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3184
Summary {0: 2, 1: 5, 2: 98, 3: 701, 4: 2378}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159634665_1159634675 15 Left 1159634665 18:70790091-70790113 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 1159634675 18:70790129-70790151 TACAATTCGAGGTGAGATTTGGG 0: 54
1: 1836
2: 10721
3: 11840
4: 8164
1159634665_1159634676 18 Left 1159634665 18:70790091-70790113 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 1159634676 18:70790132-70790154 AATTCGAGGTGAGATTTGGGTGG 0: 51
1: 1827
2: 11312
3: 12512
4: 8835
1159634665_1159634677 19 Left 1159634665 18:70790091-70790113 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 1159634677 18:70790133-70790155 ATTCGAGGTGAGATTTGGGTGGG 0: 50
1: 1857
2: 11259
3: 12081
4: 9689
1159634665_1159634673 4 Left 1159634665 18:70790091-70790113 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 1159634673 18:70790118-70790140 GTGGGGATTATTACAATTCGAGG No data
1159634665_1159634678 20 Left 1159634665 18:70790091-70790113 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 1159634678 18:70790134-70790156 TTCGAGGTGAGATTTGGGTGGGG 0: 48
1: 1782
2: 11118
3: 12468
4: 8696
1159634665_1159634674 14 Left 1159634665 18:70790091-70790113 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 1159634674 18:70790128-70790150 TTACAATTCGAGGTGAGATTTGG 0: 53
1: 1554
2: 5466
3: 12666
4: 11720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159634665 Original CRISPR CATGAGAGGGAGCTGGTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr