ID: 1159634666

View in Genome Browser
Species Human (GRCh38)
Location 18:70790095-70790117
Sequence ATGTCATGAGAGGGAGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159634666_1159634676 14 Left 1159634666 18:70790095-70790117 CCACCAGCTCCCTCTCATGACAT No data
Right 1159634676 18:70790132-70790154 AATTCGAGGTGAGATTTGGGTGG 0: 51
1: 1827
2: 11312
3: 12512
4: 8835
1159634666_1159634677 15 Left 1159634666 18:70790095-70790117 CCACCAGCTCCCTCTCATGACAT No data
Right 1159634677 18:70790133-70790155 ATTCGAGGTGAGATTTGGGTGGG 0: 50
1: 1857
2: 11259
3: 12081
4: 9689
1159634666_1159634675 11 Left 1159634666 18:70790095-70790117 CCACCAGCTCCCTCTCATGACAT No data
Right 1159634675 18:70790129-70790151 TACAATTCGAGGTGAGATTTGGG 0: 54
1: 1836
2: 10721
3: 11840
4: 8164
1159634666_1159634673 0 Left 1159634666 18:70790095-70790117 CCACCAGCTCCCTCTCATGACAT No data
Right 1159634673 18:70790118-70790140 GTGGGGATTATTACAATTCGAGG No data
1159634666_1159634678 16 Left 1159634666 18:70790095-70790117 CCACCAGCTCCCTCTCATGACAT No data
Right 1159634678 18:70790134-70790156 TTCGAGGTGAGATTTGGGTGGGG 0: 48
1: 1782
2: 11118
3: 12468
4: 8696
1159634666_1159634674 10 Left 1159634666 18:70790095-70790117 CCACCAGCTCCCTCTCATGACAT No data
Right 1159634674 18:70790128-70790150 TTACAATTCGAGGTGAGATTTGG 0: 53
1: 1554
2: 5466
3: 12666
4: 11720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159634666 Original CRISPR ATGTCATGAGAGGGAGCTGG TGG (reversed) Intergenic
No off target data available for this crispr