ID: 1159634672

View in Genome Browser
Species Human (GRCh38)
Location 18:70790105-70790127
Sequence TAATCCCCACATGTCATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10794
Summary {0: 35, 1: 469, 2: 1595, 3: 3301, 4: 5394}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159634672_1159634679 29 Left 1159634672 18:70790105-70790127 CCTCTCATGACATGTGGGGATTA 0: 35
1: 469
2: 1595
3: 3301
4: 5394
Right 1159634679 18:70790157-70790179 ACACAGAGCCAAACCATATCAGG 0: 207
1: 407
2: 526
3: 993
4: 1063
1159634672_1159634674 0 Left 1159634672 18:70790105-70790127 CCTCTCATGACATGTGGGGATTA 0: 35
1: 469
2: 1595
3: 3301
4: 5394
Right 1159634674 18:70790128-70790150 TTACAATTCGAGGTGAGATTTGG 0: 53
1: 1554
2: 5466
3: 12666
4: 11720
1159634672_1159634675 1 Left 1159634672 18:70790105-70790127 CCTCTCATGACATGTGGGGATTA 0: 35
1: 469
2: 1595
3: 3301
4: 5394
Right 1159634675 18:70790129-70790151 TACAATTCGAGGTGAGATTTGGG 0: 54
1: 1836
2: 10721
3: 11840
4: 8164
1159634672_1159634678 6 Left 1159634672 18:70790105-70790127 CCTCTCATGACATGTGGGGATTA 0: 35
1: 469
2: 1595
3: 3301
4: 5394
Right 1159634678 18:70790134-70790156 TTCGAGGTGAGATTTGGGTGGGG 0: 48
1: 1782
2: 11118
3: 12468
4: 8696
1159634672_1159634677 5 Left 1159634672 18:70790105-70790127 CCTCTCATGACATGTGGGGATTA 0: 35
1: 469
2: 1595
3: 3301
4: 5394
Right 1159634677 18:70790133-70790155 ATTCGAGGTGAGATTTGGGTGGG 0: 50
1: 1857
2: 11259
3: 12081
4: 9689
1159634672_1159634673 -10 Left 1159634672 18:70790105-70790127 CCTCTCATGACATGTGGGGATTA 0: 35
1: 469
2: 1595
3: 3301
4: 5394
Right 1159634673 18:70790118-70790140 GTGGGGATTATTACAATTCGAGG No data
1159634672_1159634676 4 Left 1159634672 18:70790105-70790127 CCTCTCATGACATGTGGGGATTA 0: 35
1: 469
2: 1595
3: 3301
4: 5394
Right 1159634676 18:70790132-70790154 AATTCGAGGTGAGATTTGGGTGG 0: 51
1: 1827
2: 11312
3: 12512
4: 8835

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159634672 Original CRISPR TAATCCCCACATGTCATGAG AGG (reversed) Intergenic
Too many off-targets to display for this crispr