ID: 1159634674

View in Genome Browser
Species Human (GRCh38)
Location 18:70790128-70790150
Sequence TTACAATTCGAGGTGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31459
Summary {0: 53, 1: 1554, 2: 5466, 3: 12666, 4: 11720}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159634665_1159634674 14 Left 1159634665 18:70790091-70790113 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 1159634674 18:70790128-70790150 TTACAATTCGAGGTGAGATTTGG 0: 53
1: 1554
2: 5466
3: 12666
4: 11720
1159634663_1159634674 29 Left 1159634663 18:70790076-70790098 CCCATGATTCAATTACCTTCCAC 0: 166
1: 3359
2: 6675
3: 9465
4: 10447
Right 1159634674 18:70790128-70790150 TTACAATTCGAGGTGAGATTTGG 0: 53
1: 1554
2: 5466
3: 12666
4: 11720
1159634667_1159634674 7 Left 1159634667 18:70790098-70790120 CCAGCTCCCTCTCATGACATGTG No data
Right 1159634674 18:70790128-70790150 TTACAATTCGAGGTGAGATTTGG 0: 53
1: 1554
2: 5466
3: 12666
4: 11720
1159634672_1159634674 0 Left 1159634672 18:70790105-70790127 CCTCTCATGACATGTGGGGATTA 0: 35
1: 469
2: 1595
3: 3301
4: 5394
Right 1159634674 18:70790128-70790150 TTACAATTCGAGGTGAGATTTGG 0: 53
1: 1554
2: 5466
3: 12666
4: 11720
1159634671_1159634674 1 Left 1159634671 18:70790104-70790126 CCCTCTCATGACATGTGGGGATT 0: 32
1: 472
2: 1424
3: 3266
4: 5843
Right 1159634674 18:70790128-70790150 TTACAATTCGAGGTGAGATTTGG 0: 53
1: 1554
2: 5466
3: 12666
4: 11720
1159634662_1159634674 30 Left 1159634662 18:70790075-70790097 CCCCATGATTCAATTACCTTCCA 0: 178
1: 3381
2: 6698
3: 9592
4: 11032
Right 1159634674 18:70790128-70790150 TTACAATTCGAGGTGAGATTTGG 0: 53
1: 1554
2: 5466
3: 12666
4: 11720
1159634666_1159634674 10 Left 1159634666 18:70790095-70790117 CCACCAGCTCCCTCTCATGACAT No data
Right 1159634674 18:70790128-70790150 TTACAATTCGAGGTGAGATTTGG 0: 53
1: 1554
2: 5466
3: 12666
4: 11720
1159634664_1159634674 28 Left 1159634664 18:70790077-70790099 CCATGATTCAATTACCTTCCACC 0: 109
1: 2008
2: 5532
3: 9528
4: 10863
Right 1159634674 18:70790128-70790150 TTACAATTCGAGGTGAGATTTGG 0: 53
1: 1554
2: 5466
3: 12666
4: 11720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159634674 Original CRISPR TTACAATTCGAGGTGAGATT TGG Intergenic
Too many off-targets to display for this crispr