ID: 1159634677

View in Genome Browser
Species Human (GRCh38)
Location 18:70790133-70790155
Sequence ATTCGAGGTGAGATTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34936
Summary {0: 50, 1: 1857, 2: 11259, 3: 12081, 4: 9689}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159634671_1159634677 6 Left 1159634671 18:70790104-70790126 CCCTCTCATGACATGTGGGGATT 0: 32
1: 472
2: 1424
3: 3266
4: 5843
Right 1159634677 18:70790133-70790155 ATTCGAGGTGAGATTTGGGTGGG 0: 50
1: 1857
2: 11259
3: 12081
4: 9689
1159634665_1159634677 19 Left 1159634665 18:70790091-70790113 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 1159634677 18:70790133-70790155 ATTCGAGGTGAGATTTGGGTGGG 0: 50
1: 1857
2: 11259
3: 12081
4: 9689
1159634666_1159634677 15 Left 1159634666 18:70790095-70790117 CCACCAGCTCCCTCTCATGACAT No data
Right 1159634677 18:70790133-70790155 ATTCGAGGTGAGATTTGGGTGGG 0: 50
1: 1857
2: 11259
3: 12081
4: 9689
1159634667_1159634677 12 Left 1159634667 18:70790098-70790120 CCAGCTCCCTCTCATGACATGTG No data
Right 1159634677 18:70790133-70790155 ATTCGAGGTGAGATTTGGGTGGG 0: 50
1: 1857
2: 11259
3: 12081
4: 9689
1159634672_1159634677 5 Left 1159634672 18:70790105-70790127 CCTCTCATGACATGTGGGGATTA 0: 35
1: 469
2: 1595
3: 3301
4: 5394
Right 1159634677 18:70790133-70790155 ATTCGAGGTGAGATTTGGGTGGG 0: 50
1: 1857
2: 11259
3: 12081
4: 9689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159634677 Original CRISPR ATTCGAGGTGAGATTTGGGT GGG Intergenic
Too many off-targets to display for this crispr