ID: 1159634678

View in Genome Browser
Species Human (GRCh38)
Location 18:70790134-70790156
Sequence TTCGAGGTGAGATTTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34112
Summary {0: 48, 1: 1782, 2: 11118, 3: 12468, 4: 8696}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159634666_1159634678 16 Left 1159634666 18:70790095-70790117 CCACCAGCTCCCTCTCATGACAT No data
Right 1159634678 18:70790134-70790156 TTCGAGGTGAGATTTGGGTGGGG 0: 48
1: 1782
2: 11118
3: 12468
4: 8696
1159634667_1159634678 13 Left 1159634667 18:70790098-70790120 CCAGCTCCCTCTCATGACATGTG No data
Right 1159634678 18:70790134-70790156 TTCGAGGTGAGATTTGGGTGGGG 0: 48
1: 1782
2: 11118
3: 12468
4: 8696
1159634671_1159634678 7 Left 1159634671 18:70790104-70790126 CCCTCTCATGACATGTGGGGATT 0: 32
1: 472
2: 1424
3: 3266
4: 5843
Right 1159634678 18:70790134-70790156 TTCGAGGTGAGATTTGGGTGGGG 0: 48
1: 1782
2: 11118
3: 12468
4: 8696
1159634665_1159634678 20 Left 1159634665 18:70790091-70790113 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 1159634678 18:70790134-70790156 TTCGAGGTGAGATTTGGGTGGGG 0: 48
1: 1782
2: 11118
3: 12468
4: 8696
1159634672_1159634678 6 Left 1159634672 18:70790105-70790127 CCTCTCATGACATGTGGGGATTA 0: 35
1: 469
2: 1595
3: 3301
4: 5394
Right 1159634678 18:70790134-70790156 TTCGAGGTGAGATTTGGGTGGGG 0: 48
1: 1782
2: 11118
3: 12468
4: 8696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159634678 Original CRISPR TTCGAGGTGAGATTTGGGTG GGG Intergenic
Too many off-targets to display for this crispr