ID: 1159636952

View in Genome Browser
Species Human (GRCh38)
Location 18:70816642-70816664
Sequence CTCCCCTGGAAGCCTGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159636952_1159636958 25 Left 1159636952 18:70816642-70816664 CCCTTGCCAGGCTTCCAGGGGAG No data
Right 1159636958 18:70816690-70816712 TTGAAAATACAAAAAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159636952 Original CRISPR CTCCCCTGGAAGCCTGGCAA GGG (reversed) Intergenic
No off target data available for this crispr