ID: 1159636958

View in Genome Browser
Species Human (GRCh38)
Location 18:70816690-70816712
Sequence TTGAAAATACAAAAAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159636956_1159636958 19 Left 1159636956 18:70816648-70816670 CCAGGCTTCCAGGGGAGGGAAAA No data
Right 1159636958 18:70816690-70816712 TTGAAAATACAAAAAAAAGAAGG No data
1159636953_1159636958 24 Left 1159636953 18:70816643-70816665 CCTTGCCAGGCTTCCAGGGGAGG No data
Right 1159636958 18:70816690-70816712 TTGAAAATACAAAAAAAAGAAGG No data
1159636951_1159636958 26 Left 1159636951 18:70816641-70816663 CCCCTTGCCAGGCTTCCAGGGGA No data
Right 1159636958 18:70816690-70816712 TTGAAAATACAAAAAAAAGAAGG No data
1159636957_1159636958 11 Left 1159636957 18:70816656-70816678 CCAGGGGAGGGAAAAAACAAAAA No data
Right 1159636958 18:70816690-70816712 TTGAAAATACAAAAAAAAGAAGG No data
1159636952_1159636958 25 Left 1159636952 18:70816642-70816664 CCCTTGCCAGGCTTCCAGGGGAG No data
Right 1159636958 18:70816690-70816712 TTGAAAATACAAAAAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159636958 Original CRISPR TTGAAAATACAAAAAAAAGA AGG Intergenic
No off target data available for this crispr