ID: 1159637737

View in Genome Browser
Species Human (GRCh38)
Location 18:70825914-70825936
Sequence CTGAATACGCAAATGGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159637737_1159637743 16 Left 1159637737 18:70825914-70825936 CCATTATCCATTTGCGTATTCAG No data
Right 1159637743 18:70825953-70825975 TCCATCATTTTCTCACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159637737 Original CRISPR CTGAATACGCAAATGGATAA TGG (reversed) Intergenic
No off target data available for this crispr