ID: 1159638185

View in Genome Browser
Species Human (GRCh38)
Location 18:70831426-70831448
Sequence CTGAATACACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159638182_1159638185 16 Left 1159638182 18:70831387-70831409 CCATAATATGAGAAAATGATGGA No data
Right 1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159638185 Original CRISPR CTGAATACACAAATGGACAA TGG Intergenic
No off target data available for this crispr