ID: 1159640069

View in Genome Browser
Species Human (GRCh38)
Location 18:70853787-70853809
Sequence GTCCAACGTCACCACAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159640060_1159640069 10 Left 1159640060 18:70853754-70853776 CCAAGGCCACAGCTCCTACCCAG No data
Right 1159640069 18:70853787-70853809 GTCCAACGTCACCACAATGAAGG No data
1159640061_1159640069 4 Left 1159640061 18:70853760-70853782 CCACAGCTCCTACCCAGCCTCCG No data
Right 1159640069 18:70853787-70853809 GTCCAACGTCACCACAATGAAGG No data
1159640065_1159640069 -8 Left 1159640065 18:70853772-70853794 CCCAGCCTCCGCTGGGTCCAACG No data
Right 1159640069 18:70853787-70853809 GTCCAACGTCACCACAATGAAGG No data
1159640064_1159640069 -4 Left 1159640064 18:70853768-70853790 CCTACCCAGCCTCCGCTGGGTCC No data
Right 1159640069 18:70853787-70853809 GTCCAACGTCACCACAATGAAGG No data
1159640066_1159640069 -9 Left 1159640066 18:70853773-70853795 CCAGCCTCCGCTGGGTCCAACGT No data
Right 1159640069 18:70853787-70853809 GTCCAACGTCACCACAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159640069 Original CRISPR GTCCAACGTCACCACAATGA AGG Intergenic
No off target data available for this crispr