ID: 1159651271

View in Genome Browser
Species Human (GRCh38)
Location 18:70981961-70981983
Sequence CTGGTTCCCCAGACAGGGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159651271_1159651277 15 Left 1159651271 18:70981961-70981983 CCGTACCCTGTCTGGGGAACCAG No data
Right 1159651277 18:70981999-70982021 GTGGACTCAGTAAATGTACCTGG No data
1159651271_1159651278 16 Left 1159651271 18:70981961-70981983 CCGTACCCTGTCTGGGGAACCAG No data
Right 1159651278 18:70982000-70982022 TGGACTCAGTAAATGTACCTGGG No data
1159651271_1159651275 -4 Left 1159651271 18:70981961-70981983 CCGTACCCTGTCTGGGGAACCAG No data
Right 1159651275 18:70981980-70982002 CCAGCTTCCTCTACATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159651271 Original CRISPR CTGGTTCCCCAGACAGGGTA CGG (reversed) Intergenic
No off target data available for this crispr