ID: 1159651275

View in Genome Browser
Species Human (GRCh38)
Location 18:70981980-70982002
Sequence CCAGCTTCCTCTACATAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159651265_1159651275 18 Left 1159651265 18:70981939-70981961 CCCTCGATGAGAGGCAGATCCTC No data
Right 1159651275 18:70981980-70982002 CCAGCTTCCTCTACATAAAGTGG No data
1159651262_1159651275 30 Left 1159651262 18:70981927-70981949 CCCTCTGAATCTCCCTCGATGAG No data
Right 1159651275 18:70981980-70982002 CCAGCTTCCTCTACATAAAGTGG No data
1159651270_1159651275 -1 Left 1159651270 18:70981958-70981980 CCTCCGTACCCTGTCTGGGGAAC No data
Right 1159651275 18:70981980-70982002 CCAGCTTCCTCTACATAAAGTGG No data
1159651263_1159651275 29 Left 1159651263 18:70981928-70981950 CCTCTGAATCTCCCTCGATGAGA No data
Right 1159651275 18:70981980-70982002 CCAGCTTCCTCTACATAAAGTGG No data
1159651272_1159651275 -9 Left 1159651272 18:70981966-70981988 CCCTGTCTGGGGAACCAGCTTCC No data
Right 1159651275 18:70981980-70982002 CCAGCTTCCTCTACATAAAGTGG No data
1159651273_1159651275 -10 Left 1159651273 18:70981967-70981989 CCTGTCTGGGGAACCAGCTTCCT No data
Right 1159651275 18:70981980-70982002 CCAGCTTCCTCTACATAAAGTGG No data
1159651271_1159651275 -4 Left 1159651271 18:70981961-70981983 CCGTACCCTGTCTGGGGAACCAG No data
Right 1159651275 18:70981980-70982002 CCAGCTTCCTCTACATAAAGTGG No data
1159651266_1159651275 17 Left 1159651266 18:70981940-70981962 CCTCGATGAGAGGCAGATCCTCC No data
Right 1159651275 18:70981980-70982002 CCAGCTTCCTCTACATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159651275 Original CRISPR CCAGCTTCCTCTACATAAAG TGG Intergenic
No off target data available for this crispr