ID: 1159651277

View in Genome Browser
Species Human (GRCh38)
Location 18:70981999-70982021
Sequence GTGGACTCAGTAAATGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159651270_1159651277 18 Left 1159651270 18:70981958-70981980 CCTCCGTACCCTGTCTGGGGAAC No data
Right 1159651277 18:70981999-70982021 GTGGACTCAGTAAATGTACCTGG No data
1159651273_1159651277 9 Left 1159651273 18:70981967-70981989 CCTGTCTGGGGAACCAGCTTCCT No data
Right 1159651277 18:70981999-70982021 GTGGACTCAGTAAATGTACCTGG No data
1159651272_1159651277 10 Left 1159651272 18:70981966-70981988 CCCTGTCTGGGGAACCAGCTTCC No data
Right 1159651277 18:70981999-70982021 GTGGACTCAGTAAATGTACCTGG No data
1159651274_1159651277 -4 Left 1159651274 18:70981980-70982002 CCAGCTTCCTCTACATAAAGTGG No data
Right 1159651277 18:70981999-70982021 GTGGACTCAGTAAATGTACCTGG No data
1159651271_1159651277 15 Left 1159651271 18:70981961-70981983 CCGTACCCTGTCTGGGGAACCAG No data
Right 1159651277 18:70981999-70982021 GTGGACTCAGTAAATGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159651277 Original CRISPR GTGGACTCAGTAAATGTACC TGG Intergenic
No off target data available for this crispr