ID: 1159651302

View in Genome Browser
Species Human (GRCh38)
Location 18:70982261-70982283
Sequence CATAATAGCTTATATTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159651302_1159651305 23 Left 1159651302 18:70982261-70982283 CCTCTGGAATATAAGCTATTATG No data
Right 1159651305 18:70982307-70982329 CGAGTGTTCATGCTCCATCAAGG No data
1159651302_1159651304 -2 Left 1159651302 18:70982261-70982283 CCTCTGGAATATAAGCTATTATG No data
Right 1159651304 18:70982282-70982304 TGAAGGAAAAGAAGAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159651302 Original CRISPR CATAATAGCTTATATTCCAG AGG (reversed) Intergenic
No off target data available for this crispr