ID: 1159652088

View in Genome Browser
Species Human (GRCh38)
Location 18:70989181-70989203
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159652088_1159652092 12 Left 1159652088 18:70989181-70989203 CCATACTTCCCCAGATAATTCTG No data
Right 1159652092 18:70989216-70989238 TTTTAATATTGATTTTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159652088 Original CRISPR CAGAATTATCTGGGGAAGTA TGG (reversed) Intergenic
No off target data available for this crispr