ID: 1159654227

View in Genome Browser
Species Human (GRCh38)
Location 18:71012382-71012404
Sequence GTCTGTTGATGTACATCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159654225_1159654227 -9 Left 1159654225 18:71012368-71012390 CCACTGTATCCAGGGTCTGTTGA No data
Right 1159654227 18:71012382-71012404 GTCTGTTGATGTACATCTAATGG No data
1159654221_1159654227 7 Left 1159654221 18:71012352-71012374 CCAAACCTTAGCTAATCCACTGT No data
Right 1159654227 18:71012382-71012404 GTCTGTTGATGTACATCTAATGG No data
1159654222_1159654227 2 Left 1159654222 18:71012357-71012379 CCTTAGCTAATCCACTGTATCCA No data
Right 1159654227 18:71012382-71012404 GTCTGTTGATGTACATCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159654227 Original CRISPR GTCTGTTGATGTACATCTAA TGG Intergenic
No off target data available for this crispr