ID: 1159655367

View in Genome Browser
Species Human (GRCh38)
Location 18:71025964-71025986
Sequence TTGTGAAAACAGATGGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159655364_1159655367 -6 Left 1159655364 18:71025947-71025969 CCTTATTCATCTGGCCTTTGTGA No data
Right 1159655367 18:71025964-71025986 TTGTGAAAACAGATGGTTCAAGG No data
1159655361_1159655367 22 Left 1159655361 18:71025919-71025941 CCACCATCAAAAATGCACAGGAA No data
Right 1159655367 18:71025964-71025986 TTGTGAAAACAGATGGTTCAAGG No data
1159655362_1159655367 19 Left 1159655362 18:71025922-71025944 CCATCAAAAATGCACAGGAAGTC No data
Right 1159655367 18:71025964-71025986 TTGTGAAAACAGATGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159655367 Original CRISPR TTGTGAAAACAGATGGTTCA AGG Intergenic
No off target data available for this crispr