ID: 1159655684

View in Genome Browser
Species Human (GRCh38)
Location 18:71028538-71028560
Sequence TCCCTGGGATGCTGCCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159655677_1159655684 12 Left 1159655677 18:71028503-71028525 CCTTGGGCCGGCGAGGCAGCTGC No data
Right 1159655684 18:71028538-71028560 TCCCTGGGATGCTGCCGCCCGGG No data
1159655674_1159655684 25 Left 1159655674 18:71028490-71028512 CCAAGAAGAGACTCCTTGGGCCG No data
Right 1159655684 18:71028538-71028560 TCCCTGGGATGCTGCCGCCCGGG No data
1159655679_1159655684 5 Left 1159655679 18:71028510-71028532 CCGGCGAGGCAGCTGCAGGCCGT No data
Right 1159655684 18:71028538-71028560 TCCCTGGGATGCTGCCGCCCGGG No data
1159655671_1159655684 30 Left 1159655671 18:71028485-71028507 CCTGGCCAAGAAGAGACTCCTTG No data
Right 1159655684 18:71028538-71028560 TCCCTGGGATGCTGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159655684 Original CRISPR TCCCTGGGATGCTGCCGCCC GGG Intergenic
No off target data available for this crispr