ID: 1159662394

View in Genome Browser
Species Human (GRCh38)
Location 18:71114789-71114811
Sequence TTTCCTGAGAACATACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159662394_1159662402 24 Left 1159662394 18:71114789-71114811 CCCTCCTGTATGTTCTCAGGAAA No data
Right 1159662402 18:71114836-71114858 GCTGGCCCACACGCAAACCTGGG No data
1159662394_1159662401 23 Left 1159662394 18:71114789-71114811 CCCTCCTGTATGTTCTCAGGAAA No data
Right 1159662401 18:71114835-71114857 TGCTGGCCCACACGCAAACCTGG No data
1159662394_1159662399 6 Left 1159662394 18:71114789-71114811 CCCTCCTGTATGTTCTCAGGAAA No data
Right 1159662399 18:71114818-71114840 ATCGGCTCACCTCAAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159662394 Original CRISPR TTTCCTGAGAACATACAGGA GGG (reversed) Intergenic
No off target data available for this crispr