ID: 1159666256

View in Genome Browser
Species Human (GRCh38)
Location 18:71163821-71163843
Sequence GATGCTGGTGCTCCCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159666256_1159666261 4 Left 1159666256 18:71163821-71163843 CCCACCTGGGGAGCACCAGCATC No data
Right 1159666261 18:71163848-71163870 CAGACTTATTCCCATTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159666256 Original CRISPR GATGCTGGTGCTCCCCAGGT GGG (reversed) Intergenic
No off target data available for this crispr