ID: 1159674361

View in Genome Browser
Species Human (GRCh38)
Location 18:71263188-71263210
Sequence TATCGCAGCTTGGAAAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159674361_1159674363 18 Left 1159674361 18:71263188-71263210 CCATTATTTTCCAAGCTGCGATA No data
Right 1159674363 18:71263229-71263251 AGTTTTTGTAAAGATTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159674361 Original CRISPR TATCGCAGCTTGGAAAATAA TGG (reversed) Intergenic
No off target data available for this crispr