ID: 1159676580

View in Genome Browser
Species Human (GRCh38)
Location 18:71291134-71291156
Sequence GAAAAATAGTAACTTTACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159676580_1159676585 24 Left 1159676580 18:71291134-71291156 CCACTGTAAAGTTACTATTTTTC No data
Right 1159676585 18:71291181-71291203 ACATGCTAGGCCACTCTCAAAGG No data
1159676580_1159676584 11 Left 1159676580 18:71291134-71291156 CCACTGTAAAGTTACTATTTTTC No data
Right 1159676584 18:71291168-71291190 ACTGTTTAAAGCAACATGCTAGG No data
1159676580_1159676586 25 Left 1159676580 18:71291134-71291156 CCACTGTAAAGTTACTATTTTTC No data
Right 1159676586 18:71291182-71291204 CATGCTAGGCCACTCTCAAAGGG No data
1159676580_1159676588 30 Left 1159676580 18:71291134-71291156 CCACTGTAAAGTTACTATTTTTC No data
Right 1159676588 18:71291187-71291209 TAGGCCACTCTCAAAGGGAAGGG No data
1159676580_1159676587 29 Left 1159676580 18:71291134-71291156 CCACTGTAAAGTTACTATTTTTC No data
Right 1159676587 18:71291186-71291208 CTAGGCCACTCTCAAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159676580 Original CRISPR GAAAAATAGTAACTTTACAG TGG (reversed) Intergenic
No off target data available for this crispr