ID: 1159676583

View in Genome Browser
Species Human (GRCh38)
Location 18:71291162-71291184
Sequence ATGTTGCTTTAAACAGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159676583_1159676591 29 Left 1159676583 18:71291162-71291184 CCATACACTGTTTAAAGCAACAT No data
Right 1159676591 18:71291214-71291236 AAGAACTACCTTCTGGAGAGAGG No data
1159676583_1159676590 22 Left 1159676583 18:71291162-71291184 CCATACACTGTTTAAAGCAACAT No data
Right 1159676590 18:71291207-71291229 GGGAATTAAGAACTACCTTCTGG No data
1159676583_1159676586 -3 Left 1159676583 18:71291162-71291184 CCATACACTGTTTAAAGCAACAT No data
Right 1159676586 18:71291182-71291204 CATGCTAGGCCACTCTCAAAGGG No data
1159676583_1159676585 -4 Left 1159676583 18:71291162-71291184 CCATACACTGTTTAAAGCAACAT No data
Right 1159676585 18:71291181-71291203 ACATGCTAGGCCACTCTCAAAGG No data
1159676583_1159676587 1 Left 1159676583 18:71291162-71291184 CCATACACTGTTTAAAGCAACAT No data
Right 1159676587 18:71291186-71291208 CTAGGCCACTCTCAAAGGGAAGG No data
1159676583_1159676588 2 Left 1159676583 18:71291162-71291184 CCATACACTGTTTAAAGCAACAT No data
Right 1159676588 18:71291187-71291209 TAGGCCACTCTCAAAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159676583 Original CRISPR ATGTTGCTTTAAACAGTGTA TGG (reversed) Intergenic
No off target data available for this crispr