ID: 1159676588

View in Genome Browser
Species Human (GRCh38)
Location 18:71291187-71291209
Sequence TAGGCCACTCTCAAAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159676580_1159676588 30 Left 1159676580 18:71291134-71291156 CCACTGTAAAGTTACTATTTTTC No data
Right 1159676588 18:71291187-71291209 TAGGCCACTCTCAAAGGGAAGGG No data
1159676583_1159676588 2 Left 1159676583 18:71291162-71291184 CCATACACTGTTTAAAGCAACAT No data
Right 1159676588 18:71291187-71291209 TAGGCCACTCTCAAAGGGAAGGG No data
1159676581_1159676588 8 Left 1159676581 18:71291156-71291178 CCTTTCCCATACACTGTTTAAAG No data
Right 1159676588 18:71291187-71291209 TAGGCCACTCTCAAAGGGAAGGG No data
1159676582_1159676588 3 Left 1159676582 18:71291161-71291183 CCCATACACTGTTTAAAGCAACA No data
Right 1159676588 18:71291187-71291209 TAGGCCACTCTCAAAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159676588 Original CRISPR TAGGCCACTCTCAAAGGGAA GGG Intergenic
No off target data available for this crispr