ID: 1159676590

View in Genome Browser
Species Human (GRCh38)
Location 18:71291207-71291229
Sequence GGGAATTAAGAACTACCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159676589_1159676590 -7 Left 1159676589 18:71291191-71291213 CCACTCTCAAAGGGAAGGGAATT No data
Right 1159676590 18:71291207-71291229 GGGAATTAAGAACTACCTTCTGG No data
1159676583_1159676590 22 Left 1159676583 18:71291162-71291184 CCATACACTGTTTAAAGCAACAT No data
Right 1159676590 18:71291207-71291229 GGGAATTAAGAACTACCTTCTGG No data
1159676582_1159676590 23 Left 1159676582 18:71291161-71291183 CCCATACACTGTTTAAAGCAACA No data
Right 1159676590 18:71291207-71291229 GGGAATTAAGAACTACCTTCTGG No data
1159676581_1159676590 28 Left 1159676581 18:71291156-71291178 CCTTTCCCATACACTGTTTAAAG No data
Right 1159676590 18:71291207-71291229 GGGAATTAAGAACTACCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159676590 Original CRISPR GGGAATTAAGAACTACCTTC TGG Intergenic
No off target data available for this crispr