ID: 1159676591

View in Genome Browser
Species Human (GRCh38)
Location 18:71291214-71291236
Sequence AAGAACTACCTTCTGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159676582_1159676591 30 Left 1159676582 18:71291161-71291183 CCCATACACTGTTTAAAGCAACA No data
Right 1159676591 18:71291214-71291236 AAGAACTACCTTCTGGAGAGAGG No data
1159676583_1159676591 29 Left 1159676583 18:71291162-71291184 CCATACACTGTTTAAAGCAACAT No data
Right 1159676591 18:71291214-71291236 AAGAACTACCTTCTGGAGAGAGG No data
1159676589_1159676591 0 Left 1159676589 18:71291191-71291213 CCACTCTCAAAGGGAAGGGAATT No data
Right 1159676591 18:71291214-71291236 AAGAACTACCTTCTGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159676591 Original CRISPR AAGAACTACCTTCTGGAGAG AGG Intergenic
No off target data available for this crispr