ID: 1159679109

View in Genome Browser
Species Human (GRCh38)
Location 18:71325482-71325504
Sequence TTGTGATTATGAAGGTGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159679107_1159679109 14 Left 1159679107 18:71325445-71325467 CCTGAAAAAACTGCAAGTCAGAG No data
Right 1159679109 18:71325482-71325504 TTGTGATTATGAAGGTGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159679109 Original CRISPR TTGTGATTATGAAGGTGACG TGG Intergenic
No off target data available for this crispr