ID: 1159688193

View in Genome Browser
Species Human (GRCh38)
Location 18:71449873-71449895
Sequence ATAAAGAGACTACAATGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159688193_1159688200 9 Left 1159688193 18:71449873-71449895 CCCCCCCATTGTAGTCTCTTTAT No data
Right 1159688200 18:71449905-71449927 TCTATATTGGTTTGTTTTCTTGG No data
1159688193_1159688199 -4 Left 1159688193 18:71449873-71449895 CCCCCCCATTGTAGTCTCTTTAT No data
Right 1159688199 18:71449892-71449914 TTATCAGAGTTTCTCTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159688193 Original CRISPR ATAAAGAGACTACAATGGGG GGG (reversed) Intergenic
No off target data available for this crispr