ID: 1159692375

View in Genome Browser
Species Human (GRCh38)
Location 18:71504913-71504935
Sequence GGGCCACTCTCATGGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159692375_1159692380 5 Left 1159692375 18:71504913-71504935 CCTGGCTTCCATGAGAGTGGCCC No data
Right 1159692380 18:71504941-71504963 ACAACATCAATGAAGGCAGTAGG No data
1159692375_1159692379 -2 Left 1159692375 18:71504913-71504935 CCTGGCTTCCATGAGAGTGGCCC No data
Right 1159692379 18:71504934-71504956 CCTTTACACAACATCAATGAAGG No data
1159692375_1159692381 13 Left 1159692375 18:71504913-71504935 CCTGGCTTCCATGAGAGTGGCCC No data
Right 1159692381 18:71504949-71504971 AATGAAGGCAGTAGGAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159692375 Original CRISPR GGGCCACTCTCATGGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr