ID: 1159696122

View in Genome Browser
Species Human (GRCh38)
Location 18:71558131-71558153
Sequence CACACTGATGTCAAAACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159696115_1159696122 27 Left 1159696115 18:71558081-71558103 CCATAAGCTTTAAGCACGTACTA No data
Right 1159696122 18:71558131-71558153 CACACTGATGTCAAAACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159696122 Original CRISPR CACACTGATGTCAAAACTGG AGG Intergenic
No off target data available for this crispr