ID: 1159696800

View in Genome Browser
Species Human (GRCh38)
Location 18:71569013-71569035
Sequence TTGGGTGAACTGATGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159696794_1159696800 10 Left 1159696794 18:71568980-71569002 CCTCAGATGTGTTAAGTTACTTG No data
Right 1159696800 18:71569013-71569035 TTGGGTGAACTGATGGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159696800 Original CRISPR TTGGGTGAACTGATGGTGAA TGG Intergenic
No off target data available for this crispr