ID: 1159697316

View in Genome Browser
Species Human (GRCh38)
Location 18:71575851-71575873
Sequence ACTAGGCAGTACCCCAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159697310_1159697316 -5 Left 1159697310 18:71575833-71575855 CCTTCATCTCACAGCTCCACTAG No data
Right 1159697316 18:71575851-71575873 ACTAGGCAGTACCCCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159697316 Original CRISPR ACTAGGCAGTACCCCAGTGG GGG Intergenic