ID: 1159698434

View in Genome Browser
Species Human (GRCh38)
Location 18:71591282-71591304
Sequence TTGAAGATGCTTGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159698429_1159698434 22 Left 1159698429 18:71591237-71591259 CCAGAGTTAGTTTTAGGGAGATG No data
Right 1159698434 18:71591282-71591304 TTGAAGATGCTTGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159698434 Original CRISPR TTGAAGATGCTTGAGGTGGA AGG Intergenic
No off target data available for this crispr