ID: 1159700384

View in Genome Browser
Species Human (GRCh38)
Location 18:71619038-71619060
Sequence GGATGATGGTTTGCTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159700381_1159700384 6 Left 1159700381 18:71619009-71619031 CCTTGGTGTTGATGACTGCTGGT No data
Right 1159700384 18:71619038-71619060 GGATGATGGTTTGCTGAAACTGG No data
1159700378_1159700384 23 Left 1159700378 18:71618992-71619014 CCTGGTGGAGGCTCTCACCTTGG No data
Right 1159700384 18:71619038-71619060 GGATGATGGTTTGCTGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159700384 Original CRISPR GGATGATGGTTTGCTGAAAC TGG Intergenic
No off target data available for this crispr