ID: 1159700941

View in Genome Browser
Species Human (GRCh38)
Location 18:71625662-71625684
Sequence CATTAACTGTTCAGTGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159700941_1159700945 16 Left 1159700941 18:71625662-71625684 CCCACATCACTGAACAGTTAATG No data
Right 1159700945 18:71625701-71625723 ATCATTTTCTTTATGAGCTAAGG No data
1159700941_1159700946 17 Left 1159700941 18:71625662-71625684 CCCACATCACTGAACAGTTAATG No data
Right 1159700946 18:71625702-71625724 TCATTTTCTTTATGAGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159700941 Original CRISPR CATTAACTGTTCAGTGATGT GGG (reversed) Intergenic
No off target data available for this crispr