ID: 1159702490

View in Genome Browser
Species Human (GRCh38)
Location 18:71646423-71646445
Sequence TGGAAGCAGCATGAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159702490_1159702497 17 Left 1159702490 18:71646423-71646445 CCTTTCTCCTCATGCTGCTTCCA No data
Right 1159702497 18:71646463-71646485 CGCCCTCTTGCTCTTTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159702490 Original CRISPR TGGAAGCAGCATGAGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr