ID: 1159702843

View in Genome Browser
Species Human (GRCh38)
Location 18:71650853-71650875
Sequence GCCTTCCCAGCGGTGAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159702843_1159702847 -6 Left 1159702843 18:71650853-71650875 CCCATCCTCACCGCTGGGAAGGC No data
Right 1159702847 18:71650870-71650892 GAAGGCACCCAAATCCCTTTAGG No data
1159702843_1159702854 17 Left 1159702843 18:71650853-71650875 CCCATCCTCACCGCTGGGAAGGC No data
Right 1159702854 18:71650893-71650915 GCCTGAACAGAATATAAAGGTGG No data
1159702843_1159702857 24 Left 1159702843 18:71650853-71650875 CCCATCCTCACCGCTGGGAAGGC No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data
1159702843_1159702856 20 Left 1159702843 18:71650853-71650875 CCCATCCTCACCGCTGGGAAGGC No data
Right 1159702856 18:71650896-71650918 TGAACAGAATATAAAGGTGGAGG No data
1159702843_1159702853 14 Left 1159702843 18:71650853-71650875 CCCATCCTCACCGCTGGGAAGGC No data
Right 1159702853 18:71650890-71650912 AGGGCCTGAACAGAATATAAAGG No data
1159702843_1159702848 -5 Left 1159702843 18:71650853-71650875 CCCATCCTCACCGCTGGGAAGGC No data
Right 1159702848 18:71650871-71650893 AAGGCACCCAAATCCCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159702843 Original CRISPR GCCTTCCCAGCGGTGAGGAT GGG (reversed) Intergenic
No off target data available for this crispr